Molecular Diagnostic test design

The goal of this post is to review the known clinical variants as annotated in ClinVar, review the pathogenic variants assigned to my pet gene ACADM.  Following the review of all possible pathogenic variants, the previously discussed variant of interest LYS304GLU, created by the genomic variation dbSNP:rs77931234, will be used to design a diagnostic assay using a restriction enzymes and simulation of the resulting gel profile in DNAStar.

Using the NCBI ClinVar search tool and "ACADM" as a gene symbol returned 36 variants.  The clinical significance varied with 2 having "conflicting interpretations", 8 being "benign", 5 of "uncertain significance", 1 identified as a "risk factor", and the remaining 23 all tagged as "pathogenic".  Of the 23 "pathogenic" variants, 20 were single nucleotide polymophisms(SNP) and 3 were variations of large structural deletions of chromosome 1 (1p32.1-31.1, 1p32.3-31.1,1p31.1-13.3) and are not unique to this gene or location and variants tagged as pathogenic and associated with the disease Medium-chain acyl-coenzyme A dehydrogenase deficiency, a disease known to be associated with this locus; while the remaining had no associated condition provided.  As for the recognition of these variants, no variants have been marked (as of 11/8/2014) by either a professional society or by an expert panel.  Most were marked only as been submitted by a single submitter but 8 were tagged as being submitted from multiple sources.

Using Genetests.org and searching for the gene ACADM returned the associated disease "Medium Chain Acyl-Coenzyme A Dehydrogenase Deficiency" and the 1p31 locus.  A large number of tests were returned by in the US and globally.  Limiting results to the US only still returned a large number of results, both prenatal and carrier testing, a variety of types, 2 biochemical, 43 molecular, and 18 test for this gene which are part of a larger panel.  The methods varied a great deal from pcr, array based deletion, duplication, and copy number variation, 15 capillary sequencing, 4 genotyping assays by microarray and bead based assays, and 13 "Next Gen" sequencing which are single assays that cover many genes.  There were many core facilities but also a large number of Children's Hospitals all across the US.  Given these results I would characterize testing for this gene and its disease widely available.

For the construction of the simulated assay, the reference sequence was obtained for genome build GRCh38 for the gene locus for ACADM.  This was obtained from the NCBI gene finder, the Fastq sequence was downloaded for NC_000001.11:75724347-75763679.  The sequence was uploaded into DNAStar's SeqBuilder tool, the location of the variation was found by using DBsnp locating the page for dbSNP:rs77931234 , the variation of interest.  The variation flanking sequences "tctggtaactcattctagctagttcaactt" and "cattgccatttcagccagcataaatgatat" were used to locate the base of interest, the location of the variant can be seen in the image here:

The reference sequence of interest is"GCAATGAAAGTT" with the base of interest highlighted in blue and its variation of A->G "GCAATGGAAGTT" with the variation seen in orange.  In order to find an enzyme which would cut the sequence of interest, the NEBcutter web tool as well as Restriction Mapper were both used to try and find restriction enzyme would would be affected by the variation.  Two enzymes were returned by both tools, they are BsrDI and AgsI, BsrDI cuts right at the site of the variation however the site of recognition is not impacted by the variation, the location of cutting and the location of recognition can be seen in the image here:

By using the tools in SeqBuilder to display all of enzymes that cut a specific region I was also able to find MspJI, AbaSI, AgsI, and many others as seen here:

Unfortunately none of these were specific to cutting only this location and many of these enzymes cut multiple lotions with in the same 20 base pair region eliminating them as useful for detection of the variation. To simulate a gel, an enzyme which only cuts the sequence in fewer than 7 locations will be used, the cutting locus will be altered.  In order to simulate the gel the mRNA sequence for ACADM NP_000007.1 will be used.  It is much smaller than the genomic sequence containing only ~2600 bases.  The enzyme we will use for the simulation will be the previously identified BsrDI, while it isn't useful for detecting our variation, it cuts near it and it only cuts the sequence in one other place, meaning that the loss of one site should be observable in a gel. 

The digestion of the reference strand results in three bands, two are very close to each other and a tech would need to be sure to run the gel long enough to see these bands separate.  Destruction of the BsrDI site reduced the number of bands to 2 with the two similar sized pieces appearing as one large band at roughly 375 bases.  

While it was unfortunate that the pathogenic variation was unable to be captured using and RFLP a taq primer probe design could also be tried for the detection of this specific mutation.